mitochondrial-dna¹ (or mtdna) in human-beings is inherited by a child exclusively from their mother. therefore, as a single male child, my mother's mtdna is fatefully destined to die with me.

as an offspring with little to no tangible inheritance, learning about this instinctually made me want to preserve this piece of dna, and see it passed down to future generations. through genetic-engineering, with help from dr. ellen jorgensen at biotech without borders, we addressed this desire & successfully expressed some of my mtdna into e. coli. bacterial cells — a commonly used organism in biotech-labs.

however, the moment we did so, we killed them². millions of them — living peacefully in small colonies on a petri dish — wiped out by a human-desire to preserve a piece of maternal inheritance. analogous to a world where people increasingly preserve more — data; objects; spaces; genomes — i wonder how many such organisms will bear the price for the human inability to let go.

to present this at the itp-spring-show, i designed a small interactive-exhibit that allowed people to view microscopic footage of bacterial cells with different treatments (with & without my dna), by pressing petri-dishes.

process:

we extracted my mtdna using a cheek-swab, purified it, sent it for sequencing, and then cleaned up the sequence as part of heather-dewey-hagborg's class.

//forward sequence (cleaned):
AACTATTCTCTGTTCTTTCATGGGGAAGCAGATTTGGGTACCACCCAAGTATTGACTCACCCATCAACAACCGCTATGTATTTCGTACATTACTGCCAGCCACCATGAATATTGTACAGTACCATAAATACTTGACCACCTGTAGTGCATAAAAACCCAATCCACATCAAAACCCCCTCCCCATGCTTACAAGCAAGTACAGCAATCAACCTTCAACTATCACACATCAACTGCAACTCCAAAGCCACCCCTCACCCACTAGGATACCAACAAACCTACCCACCCTTAACAGTACATAGTACATAAAGCCATTTACCGTACATAGCACATTACAGTCAAATCCCTTCTCGTCCCCATGGATGACCCCCCTCAGATAGGGGTCCCATGACCACCATCCTCATAAA

thereafter, ellen & i sliced two subsections of that dna: one from the beginning until the first stop codon³, and the other from the last start codon till the end. we also added an expression vector⁴ & a green-fluorescent-protein to be able to visually track whether the expression was successful or not.

below is an annotated image of the whole sequence. it starts with the two subsections of my dna, the expression-vector (plasmid) in blue, and the green-fluorescent-protein in green.

then i purified the dna, checked its concentration using gel electrophoresis⁵, performed ligation⁶, cut the dna at specific points, and finally performed bacterial-transformation⁷.

finally, i spent time streaking bacterial-colonies onto agar plates to check for growth.

an in-depth log of this project can be found here.

acknowledgements:

heather dewey hagborg for her fantastic bioart-as-biopolitics class at itp; dr. ellen jorgensen & biotech without borders for letting me use their lab; tenni for helping me learn how to use a microscope; cody frost for his advice on distributing pressure on the fsrs; delaney wong & jackie nam for the pictures.

1. human mitochondrial dna was the first significant part of the human genome to be sequenced, and is actively used by ancestry-dna services (such as 23andme). read more on this wikipedia page.
2. this is, sadly, still a hypothesis (although verified by dr. ellen jorgensen). to claim this with certainty, i'd have to extract the recombinant dna, send it for sequencing, and verify whether it was actually my dna that killed the bacteria. however, to do so would require funds that i did not have at this time.
3. start & stop codons are three-letters long, and tell the ribosome where to begin & end dna-transcription (to make relevant proteins). read more on this wikipedia page.
4. an expression vector is a plasmid (a small circular piece of dna) or a virus designed to transfer (express) a gene to a particular cell. read more on this wikipedia page.
5. gel-electrophoresis is a method to analyse pieces of dna by separating large bands of dna-molecules, in an electrically charged medium. read more on this wikipedia page.
6. ligation is a step in the transformation process, to join two nucleotides into a single polymeric chain using a ligase. read more on this wikipedia page.
7. we heat-shocked the bacteria cells to break open the cell-walls, and then put the dna into the cell. read more on this wikipedia page.